Vector Wizard

Mendelgen features a Vector Wizard to create optimized viral vectors for expression in target cell types for gene therapy experiments. However, it's crucial to note that these vectors are designed solely for in vitro research and experimental purposes. They are not intended for use in living subjects, including both humans and animals. To access the Vector Wizard, on the Dashboard, select New Vector -> Viral vector wizard

In the pop-up window you can see the options:

After naming your new vector, add the sequence of your insert (gene of interest). Please use the nucleotide sequence. If you have a reporter gene, add the sequence in the field below.

You can also select the target cell type for expression. Currently available target tissues and cell types: CNS, heart, kidney, liver, lung, pancreas, eye, skeletal muscle, and systemic (no specific cell type). Selecting either of them results in adding a tissue-specific promoter to your vector.

For example, if I would like to express the MMP1 gene, I would obtain the sequence from NCBI (gene ID 4312, human, NCBI Reference Sequence: NM_001145938.2).

atattggagcagcaagaggctgggaagccatcacttaccttgcactgagaaagaagacaaaggcaagttgaaaagcggagaaatagtggcccagtggttgaaaaattgaagcaaatgcaggaattctttgggctgaaagtgactgggaaaccagatgctgaaaccctgaaggtgatgaagcagcccagatgtggagtgcctgatgtggctcagtttgtcctcactgaggggaaccctcgctgggagcaaacacatctgacctacaggattgaaaattacacgccagatttgccaagagcagatgtggaccatgccattgagaaagccttccaactctggagtaatgtcacacctctgacattcaccaaggtctctgagggtcaagcagacatcatgatatcttttgtcaggggagatcatcgggacaactctccttttgatggacctggaggaaatcttgctcatgcttttcaaccaggcccaggtattggaggggatgctcattttgatgaagatgaaaggtggaccaacaatttcagagagtacaacttacatcgtgttgcagctcatgaactcggccattctcttggactctcccattctactgatatcggggctttgatgtaccctagctacaccttcagtggtgatgttcagctagctcaggatgacattgatggcatccaagccatatatggacgttcccaaaatcctgtccagcccatcggcccacaaaccccaaaagcgtgtgacagtaagctaacctttgatgctataactacgattcggggagaagtgatgttctttaaagacagattctacatgcgcacaaatcccttctacccggaagttgagctcaatttcatttctgttttctggccacaactgccaaatgggcttgaagctgcttacgaatttgccgacagagatgaagtccggtttttcaaagggaataagtactgggctgttcagggacagaatgtgctacacggataccccaaggacatctacagctcctttggcttccctagaactgtgaagcatatcgatgctgctctttctgaggaaaacactggaaaaacctacttctttgttgctaacaaatactggaggtatgatgaatataaacgatctatggatccaggttatcccaaaatgatagcacatgactttcctggaattggccacaaagttgatgcagttttcatgaaagatggatttttctatttctttcatggaacaagacaatacaaatttgatcctaaaacgaagagaattttgactctccagaaagctaatagctggttcaactgcaggaaaaattgaacattactaatttgaatggaaaacacatggtgtgagtccaaagaaggtgttttcctgaagaactgtctattttctcagtcatttttaacctctagagtcactgatacacagaatataatcttatttatacctcagtttgcatatttttttactatttagaatgtagccctttttgtactgatataatttagttccacaaatggtgggtacaaaaagtcaagtttgtggcttatggattcatataggccagagttgcaaagatcttttccagagtatgcaactctgacgttgatcccagagagcagcttcagtgacaaacatatcctttcaagacagaaagagacaggagacatgagtctttgccggaggaaaagcagctcaagaacacatgtgcagtcactggtgtcaccctggataggcaagggataactcttctaacacaaaataagtgttttatgtttggaataaagtcaaccttgtttctactgtttta

After copying and pasting the nucleotide sequence, I have new options appearing:

• Will the gene be integrated into host DNA?
• Is it in vivo experiment?
• Will the expression be controlled?

Follow the diagram below to see the variety of options available.

Tissue specific promoters

We will demonstrate these options on examples below:

1) Gene integrated + in any cells + expression controlled

Vector: 3rd generation lentiviral vector.

The main vector features:

• 3’LTR (Delta-U3)
• 5’LTR truncated
• AmpR and AmpR promoter
• CAP binding site
• F1 ori
• HIV-1 Psi
• Lac operator and lac promoter
• Mini CMV
• Ori
• RRE
• RSV promoter
• SV40 ori
• SV40 poly(A) signal
• T3 promoter
• T7 promoter
• Tet operator

2) Gene integrated + in any cells + expression uncontrolled – in heart

Vector: 3rd generation lentiviral vector.

Main vector features:

• 3’-LTR (Delta-U3)
• 5’LTR truncated
• AmpR nd AmpR promoter
• CAP binding site
• Cardiac tropin T promoter
• F1 ori
• HIV-1 Psi
• Lac operator and lC promoter
• Ori
• RRE
• RSV promoter
• SV40 ori
• SV40 poly(A) signal
• T3 promoter
• T7 promoter

3) Gene non-integrated + in vivo + expression controlled

Vector: AAV vector expressing Myc-tagged SpCas9 under the EFS promoter.

Main vector features:

• AAV2 ITR (alternate)
• AmpR and AmpR promoter
• EF-1-alpha core promoter
• F1 ori
• Mini CMV
• Ori
• Synthetic polyA signal
• Tet operator
• Vertebrate consensus sequence for strong initiation (Kozak)

4) Gene non-integrated + in vivo + expression uncontrolled – in heart

Vector: AAV vector expressing Myc-tagged SpCas9 under the EFS promoter.

Main vector features:

• AAV2 ITR
• AAV2 ITR (alternate)
• AmpR
• AmpR promoter
• Cardiac tropin T promoter (tissue-specific promoter)
• EF-1-alpha core promoter
• F1 ori
• Ori
• Synthetic polyA signal

5) Gene non-integrated + in vitro + expression controlled

Main vector features:

• Ad5 Psi
• ITR
• M13 ori
• Mini CMV
• NeoR/KanR
• Ori
• Tet operator

6) Gene non-integrated + in vitro + expression uncontrolled – in heart

Main vector features:

• Ad5Psi
• Cardiac Tropin T promoter (tissue-specific promoter)
• ITR
• M13 ori
• NeoR/KanR
• Ori

The example of vector with reported gene (dsRed).

The reporter gene will be automatically added after the gene of interest, with a linker between them.

The default linker is (Gly4-Ser)3 (Gly-Gly-Gly-Gly-Ser sequence – three repeats)GGTGGTGGTGGTAGCGGTGGTGGTGGTAGCGGTGGTGGTGGTAGC

Appendix

Notes to specific parts of the vector used in vector wizard tool.